Collection and processing of specimens
As of Fall 2020, all employees and students on the Rockefeller University campus (approximately 1,400 people) were tested at least weekly with a saliva-based PCR test developed at the Darnell Clinical Laboratory Improvement Amendments-Clinical Laboratory Evaluation Program laboratory (approval number, PFI -9216) and approved for clinical use by an Emergency Use License in New York State. Saliva sample collection protocols for SARS-CoV-2 clinical testing were reviewed by the Rockefeller University Institutional Review Board and were considered not to be a human subject study. Written informed consent approved by the Institutional Review Board for the analysis of antibody titres was obtained from patient 1 and the study was conducted in accordance with the guidelines of the International Council for Harmonization Good Clinical Practice.
In accordance with New York State regulations for eligibility, between January 21 and March 17, 2021, 417 workers were tested who received a second dose of either the BNT162b2 (Pfizer-BioNTech) or mRNA-1273 (Moderna) vaccine . , and weekly testing continued thereafter. The demographic characteristics of these 417 individuals and 1,491 unvaccinated individuals tested in parallel at Rockefeller University during the same period are presented in Table S1 of the Supplementary Appendix, available with the full text of this article at NEJM.org.
Staff and students were instructed to place a saliva sample in a medicine cup and transfer 300 μl to a vial containing 300 μl Darnell Rockefeller University Laboratory (DRUL) buffer (5 M guanidine thiocyanate, 0.5% sarkosyl and 300 mM sodium acetate [pH 5.5]).2 Samples were processed on the Thermo KingFisher Apex Rapid RNA Purification System, and Complementary DNA (cDNA) was amplified using TaqPath 1-Step RT-qPCR (Reverse Transcriptase Quantitative PCR) Master Mix (Thermo Fisher Scientific) and Multiplex primers and probes validated under an emergency use authorization from the Food and Drug Administration (Table S2) with the 7500 Fast Dx Real-Time PCR Detection System (Applied Biosystems). Samples were considered interpretable if the cycle threshold (Ct) of the housekeeping control (RNase P) was less than 40, and viral RNA was considered to be detected with both viral primers and probes (N1 and N2, detecting two regions of the nucleocapsid ) [N] gene of SARS-CoV-2) at a Ct of less than 40.
Calculation of viral load
We calculated the viral load per milliliter of saliva using chemically inactivated SARS-CoV-2 (ZeptoMetrix) injected into saliva at various dilutions. Extractions and RT-PCR were performed as previously described to determine the corresponding Ct values for each dilution (Fig. S1).
Targeted sequencing
Reverse transcription of RNA samples was performed with the iScript mix (Bio-Rad) according to the manufacturer’s instructions. PCR amplification of cDNA was performed using two primer sets (primer set 1: forward primer 1 [CCAGATGATTTTACAGGCTGC] and reverse primer 1 [CTACTGATGTCTTGGTCATAGAC]; primer set 2: forward primer 2 [CTTGTTTTATTGCCACTAGTC] and reverse primer 1). PCR products were then extracted from the gel and sent to Genewiz for Sanger sequencing.
Neutralization test
Neutralization assays with pseudotyped replication defective human immunodeficiency virus type 1 modified with SARS-CoV-2 spike protein were performed as previously described.3 Mean serum neutralizing antibody titres (50% neutralization test [NT50]) were calculated as an average of three independent experiments, each performed using technical duplicates, and statistical significance was determined by the two-tailed Mann-Whitney test.
Whole Viral RNA Genome Sequencing
Total RNA was extracted as described above and a meta-transcriptomic library constructed for paired-end (150-bp reads) sequencing with an Illumina MiSeq platform. Libraries were prepared with the SureSelect XT HS2 DNA System (Agilent Technologies) and the Community Design Pan Human Coronavirus Panel (Agilent Technologies) according to the manufacturer’s instructions. FASTQ files (a text-based format for storing both a biological sequence and its associated quality scores) were cropped with Agilent Genomics NextGen Toolkit (AGeNT) software (version 2.0.5) and used for downstream analysis. The SARS-CoV-2 genome was assembled with MEGAHIT with standard parameters and the longest sequence (30,005 nucleotides) was analyzed with Nextclade software (https://clades.nextstrain.org/) to map the clade and call mutations . Detected mutations were confirmed by aligning RNA sequencing readings on the reference genome sequence of SARS-CoV-2 (GenBank number, NC_045512) with the Burrows-Wheeler Aligner (BWA-MEM).
Patient history
Patient 1 was a healthy 51-year-old female with no risk factors for severe Covid-19 who received the first dose of mRNA-1273 vaccine on January 21, 2021 and the second dose on February 19. She had kept a strict routine. precautionary actions. Ten hours after she received the second dose of the vaccine, flu-like muscle pain developed. These symptoms disappeared the next day. On March 10 (19 days after receiving the second vaccination dose), she developed a sore throat, constipation, and headache, and later that day she tested positive for SARS-CoV-2 RNA at Rockefeller University. On March 11, she lost her sense of smell. Her symptoms gradually disappeared over a period of 1 week.
Patient 2 was a healthy 65-year-old female with no risk factors for severe Covid-19 who received the first dose of BNT162b2 vaccine on January 19 and the second dose on February 9. Pain that developed in the inoculated arm lasted for 2 days. On March 3, her unvaccinated partner tested positive for SARS-CoV-2 and on March 16, fatigue, sinus congestion and headache developed in patient 2. On March 17, she felt worse and tested positive for SARS-CoV-2 RNA, 36 days after completion of vaccination. Her symptoms eased and started to disappear on March 20.